plko 1 shrna2 control scramble Search Results


96
Addgene inc plko 1 slug shrna2
Plko 1 Slug Shrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 slug shrna2/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 slug shrna2 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Millipore plko.1-eif3l shrna1 (5′ ccggcct ggtagacaaatccaacatctcgagatgttggatt tgtctaccaggtttttg 3′)
Plko.1 Eif3l Shrna1 (5′ Ccggcct Ggtagacaaatccaacatctcgagatgttggatt Tgtctaccaggtttttg 3′), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko.1-eif3l shrna1 (5′ ccggcct ggtagacaaatccaacatctcgagatgttggatt tgtctaccaggtttttg 3′)/product/Millipore
Average 90 stars, based on 1 article reviews
plko.1-eif3l shrna1 (5′ ccggcct ggtagacaaatccaacatctcgagatgttggatt tgtctaccaggtttttg 3′) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Addgene inc plko 1 shrna
Plko 1 Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shrna/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 shrna - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Addgene inc lentiviral plko.1 plasmids
Lentiviral Plko.1 Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral plko.1 plasmids/product/Addgene inc
Average 90 stars, based on 1 article reviews
lentiviral plko.1 plasmids - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc plko 1 shrna2 control scramble
KEY RESOURCES TABLE
Plko 1 Shrna2 Control Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shrna2 control scramble/product/Addgene inc
Average 90 stars, based on 1 article reviews
plko 1 shrna2 control scramble - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Addgene inc shrnas for deptor
KEY RESOURCES TABLE
Shrnas For Deptor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrnas for deptor/product/Addgene inc
Average 94 stars, based on 1 article reviews
shrnas for deptor - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Addgene inc plko 1 usp10 shrna 2
KEY RESOURCES TABLE
Plko 1 Usp10 Shrna 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 usp10 shrna 2/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 usp10 shrna 2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
GenScript corporation plko.1-snail-shrna2
KEY RESOURCES TABLE
Plko.1 Snail Shrna2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko.1-snail-shrna2/product/GenScript corporation
Average 90 stars, based on 1 article reviews
plko.1-snail-shrna2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Addgene inc 2014 vib ugent vector id
KEY RESOURCES TABLE
2014 Vib Ugent Vector Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2014 vib ugent vector id/product/Addgene inc
Average 93 stars, based on 1 article reviews
2014 vib ugent vector id - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

92
Addgene inc lentiviral plko 1 plasmids targeting hoxa10
Role of <t>HOXA10</t> in Gdf5 expression in articular cartilage cells. ( A ) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. ( B ) Schematic diagram of Gdf5 -HiBiT screening system. ( C ) SFZ cells were isolated from Gdf5- HiBiT KI mice and were plated on a 96-well plate. Gdf5- HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). ( E ) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).
Lentiviral Plko 1 Plasmids Targeting Hoxa10, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral plko 1 plasmids targeting hoxa10/product/Addgene inc
Average 92 stars, based on 1 article reviews
lentiviral plko 1 plasmids targeting hoxa10 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

93
Addgene inc shrna2
Role of <t>HOXA10</t> in Gdf5 expression in articular cartilage cells. ( A ) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. ( B ) Schematic diagram of Gdf5 -HiBiT screening system. ( C ) SFZ cells were isolated from Gdf5- HiBiT KI mice and were plated on a 96-well plate. Gdf5- HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). ( E ) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).
Shrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna2/product/Addgene inc
Average 93 stars, based on 1 article reviews
shrna2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Millipore plko.1 ttk shrna2 (trcn0000011012)
Role of <t>HOXA10</t> in Gdf5 expression in articular cartilage cells. ( A ) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. ( B ) Schematic diagram of Gdf5 -HiBiT screening system. ( C ) SFZ cells were isolated from Gdf5- HiBiT KI mice and were plated on a 96-well plate. Gdf5- HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). ( E ) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).
Plko.1 Ttk Shrna2 (Trcn0000011012), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko.1 ttk shrna2 (trcn0000011012)/product/Millipore
Average 90 stars, based on 1 article reviews
plko.1 ttk shrna2 (trcn0000011012) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell

Article Title: A membrane-less organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein-protein interactions

doi: 10.1016/j.cell.2018.10.007

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: pLKO.1-shRNA2 Control (scramble) , Sarbassov et al., 2005 , Addgene, Cat# 1864.

Techniques: Recombinant, Blocking Assay, Protease Inhibitor, Reverse Transcription, Mutagenesis, Plasmid Preparation, Control, Luciferase, shRNA, Software

Role of HOXA10 in Gdf5 expression in articular cartilage cells. ( A ) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. ( B ) Schematic diagram of Gdf5 -HiBiT screening system. ( C ) SFZ cells were isolated from Gdf5- HiBiT KI mice and were plated on a 96-well plate. Gdf5- HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). ( E ) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Journal: Scientific Reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Role of HOXA10 in Gdf5 expression in articular cartilage cells. ( A ) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. ( B ) Schematic diagram of Gdf5 -HiBiT screening system. ( C ) SFZ cells were isolated from Gdf5- HiBiT KI mice and were plated on a 96-well plate. Gdf5- HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). ( E ) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Article Snippet: For knockdown experiments, lentiviral pLKO.1 plasmids targeting Hoxa10 (Hoxa10 shRNA-1 target sequence, 5′-ATCCTTCATTCACCTTTGAG-3′ and Hoxa10 shRNA-2 target sequence, 5′-AAGCAAATGCATTCTATCGTT-3′, were generated in accordance with the manufacturer’s protocol (Addgene, Watertown, MA, USA).

Techniques: Expressing, Isolation, Infection, Control, Gene Expression, Quantitative RT-PCR, Cell Culture

Role of HOXA10 in Gdf5 expression in LB cells. ( A ) LB cells were isolated from Gdf5- HiBiT KI mice and plated on a 96-well plate. The cells were infected with empty (control), Venus , or FLAG- Hoxa10 lentiviruses. One day after infection, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( B ) LB cells isolated from WT mice were infected with empty (control), Venus , or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, **: P < 0.01).

Journal: Scientific Reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Role of HOXA10 in Gdf5 expression in LB cells. ( A ) LB cells were isolated from Gdf5- HiBiT KI mice and plated on a 96-well plate. The cells were infected with empty (control), Venus , or FLAG- Hoxa10 lentiviruses. One day after infection, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( B ) LB cells isolated from WT mice were infected with empty (control), Venus , or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, **: P < 0.01).

Article Snippet: For knockdown experiments, lentiviral pLKO.1 plasmids targeting Hoxa10 (Hoxa10 shRNA-1 target sequence, 5′-ATCCTTCATTCACCTTTGAG-3′ and Hoxa10 shRNA-2 target sequence, 5′-AAGCAAATGCATTCTATCGTT-3′, were generated in accordance with the manufacturer’s protocol (Addgene, Watertown, MA, USA).

Techniques: Expressing, Isolation, Infection, Control, Cell Culture, Quantitative RT-PCR

Effect of HOXA10 on the Gdf5 gene promoter. ( A ) The ATAC-Seq database (articular chondrocytes: SRX13791211, costal chondrocytes: SRX11156876) from ChIP-Atlas was analyzed by integrative genomics viewer IGV2.8.6. A Gdf5 gene promoter (1393 bp) exhibits an open chromatin region on the Gdf5 gene in articular chondrocytes. ( B ) Schematic diagram of luciferase reporter construction with mouse Gdf5 gene promoter (− 1081 to + 312). A putative HOXA10 binding motif (− 538 to − 529) is shown with reference to previous study . ( C ) HEK293T cells were transfected with empty or FLAG- Hoxa10 plasmids as well as luciferase reporter plasmids with mouse Gdf5 gene promoter. Cell lysates were subjected to luciferase measurement (n = 4). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Gdf5 gene promoter fragments collected by ChIP using anti-FLAG antibody were analyzed by real-time qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Journal: Scientific Reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Effect of HOXA10 on the Gdf5 gene promoter. ( A ) The ATAC-Seq database (articular chondrocytes: SRX13791211, costal chondrocytes: SRX11156876) from ChIP-Atlas was analyzed by integrative genomics viewer IGV2.8.6. A Gdf5 gene promoter (1393 bp) exhibits an open chromatin region on the Gdf5 gene in articular chondrocytes. ( B ) Schematic diagram of luciferase reporter construction with mouse Gdf5 gene promoter (− 1081 to + 312). A putative HOXA10 binding motif (− 538 to − 529) is shown with reference to previous study . ( C ) HEK293T cells were transfected with empty or FLAG- Hoxa10 plasmids as well as luciferase reporter plasmids with mouse Gdf5 gene promoter. Cell lysates were subjected to luciferase measurement (n = 4). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Gdf5 gene promoter fragments collected by ChIP using anti-FLAG antibody were analyzed by real-time qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).

Article Snippet: For knockdown experiments, lentiviral pLKO.1 plasmids targeting Hoxa10 (Hoxa10 shRNA-1 target sequence, 5′-ATCCTTCATTCACCTTTGAG-3′ and Hoxa10 shRNA-2 target sequence, 5′-AAGCAAATGCATTCTATCGTT-3′, were generated in accordance with the manufacturer’s protocol (Addgene, Watertown, MA, USA).

Techniques: Luciferase, Binding Assay, Transfection, Isolation, Infection, Control

Immunofluorescent analysis of HOXA10 and GDF5 in articular cartilage. Tibial sections from 3-month-old mice were subjected to co-immunostaining with anti-HOXA10 and anti-GDF5 antibodies. DAPI indicates nucleus. Scale bar, 50 μm.

Journal: Scientific Reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: Immunofluorescent analysis of HOXA10 and GDF5 in articular cartilage. Tibial sections from 3-month-old mice were subjected to co-immunostaining with anti-HOXA10 and anti-GDF5 antibodies. DAPI indicates nucleus. Scale bar, 50 μm.

Article Snippet: For knockdown experiments, lentiviral pLKO.1 plasmids targeting Hoxa10 (Hoxa10 shRNA-1 target sequence, 5′-ATCCTTCATTCACCTTTGAG-3′ and Hoxa10 shRNA-2 target sequence, 5′-AAGCAAATGCATTCTATCGTT-3′, were generated in accordance with the manufacturer’s protocol (Addgene, Watertown, MA, USA).

Techniques: Immunostaining

List of transcription factor genes predominantly expressed in articular chondrocytes by microarray analysis.

Journal: Scientific Reports

Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes

doi: 10.1038/s41598-023-50318-7

Figure Lengend Snippet: List of transcription factor genes predominantly expressed in articular chondrocytes by microarray analysis.

Article Snippet: For knockdown experiments, lentiviral pLKO.1 plasmids targeting Hoxa10 (Hoxa10 shRNA-1 target sequence, 5′-ATCCTTCATTCACCTTTGAG-3′ and Hoxa10 shRNA-2 target sequence, 5′-AAGCAAATGCATTCTATCGTT-3′, were generated in accordance with the manufacturer’s protocol (Addgene, Watertown, MA, USA).

Techniques: Microarray